energy use needed to sustain your home

Answers

Answer 1

Energy use needed to sustain your home include the following below:

Use of energy-efficient light bulbs.Clean or replace air filters.Turn off appliances when not in use etc.

What is Energy conservation?

This is referred to as the decision and practice of using less energy through the practice and adoption of certain techniques.

An example is to ensure that energy efficient light bulbs is used in homes which will help reduce the risk of energy being lost as heat and other forms. Turning off appliances when not in use too will ensure that energy is conserved in the home of an individual.

Read more about Energy conservation here https://brainly.com/question/27422874

#SPJ1

The full question:

energy use needed to sustain your home include?


Related Questions

38. Coat colour in general has intrigued scientists all over the world for centuries. Such an interest 4 could be explained by its phenotypic characteristics being easily recognizable, making it simple to follow the inheritance from generations to generations. Therefore, coat colour has become a model phenotype for studying gene action and gene interactions. The given diagrammatic representation shows the inheritance of coat colour in mice.
Analyze it carefully and answer the following questions

a. Identify the dominant and recessive trait in the coat colour.
b. Which mouse is heterozygous for coat colour-A/B/C/D? Support your choice with a valid reason
c. Find out the phenotypic and genotypic ratio if two members in the family "P" interbreeds (Show the working using a Punnett square)
d. Find out the phenotypic and genotypic ratio if a female in family P interbreeds with a white coat coloured male in family R. (Show the working using a Punnett square) ​

Answers

Inheritance of coat color in mice is determined by the interaction of genes, hormones, and environmental factors.

What do you mean by inheritance?

In biology, inheritance is the process by which characteristics are passed from one generation to the next. Inheritance occurs when an organism passes on its genes, or genetic information, to its offspring. This includes both physical traits, such as eye color and hair color, as well as more complex traits, such as intelligence and personality. Inheritance plays an important role in evolution, as it allows for the adaptation of species to their environment over time.

A. The dominant trait in the coat color is black (represented as B) and the recessive trait is white (represented as b).

B. Mouse C is heterozygous for coat color as it contains both the dominant and recessive trait (Bb).

C. The phenotypic ratio and genotypic ratio of the interbreeding between two members in family "P" will be 1:1 for both the ratio. The Punnett square for this interbreeding is shown below:

P1: BB

P2: Bb

B B

B Bb

D. The phenotypic ratio of the interbreeding between a female in family P and a white coat colored male in family R will be 3:1, with black being the dominant phenotype. The genotypic ratio will be 1:2:1, with BB, Bb, and bb being the genotypes. The Punnett square for this interbreeding is shown below:

P: Bb

R: bb

B Bb

b Bb

To know more about inheritance,

https://brainly.com/question/24113833

#SPJ1

what part of the nervous system contains the brain and spinal cord; processes, stores and responds to information from the peripheral nervous system?

Answers

Central nervous system contains the brain and spinal cord processes, stores and responds to information from the peripheral nervous system.

In general, the central nervous system's is responsible for receiving, processing, and responding to all sensory information. They take help of  peripheral nervous that is composed of nerves that branch off from the spinal cord and extend to all parts of the body.

Hence, brain and the spinal cord are enclosed and protected by bone brain is covered by bones of the skull, and the spinal cord inside a set of ring-shaped bones called vertebrae. They both are having cushioned layers that is also called meninges and a special fluid called cerebrospinal fluid.

To learn more about Central nervous system  , here

brainly.com/question/29974261

#SPJ4

what is the main purpose of the human genome project?​

Answers

to provide researchers with powerful tools to understand the genetic factors in human disease, paving the way for new strategies for their diagnosis, treatment and prevention

What is the process called when the material taken in by endocytosis is large , such as a food particle or another cell ?

Answers

Phagocytosis (literally, "cell eating") is a type of endocytosis that involves the transport of large particles into the cell, such as cells or cellular debris.

Phagocytosis is an important process for nutrition in unicellular organisms, and it is found in specialized cells called phagocytes in multicellular organisms. Phagocytosis is the recognition and ingestion of particles larger than 0.5 m into a plasma membrane-derived vesicle known as a phagosome.

Phagocytosis is the cellular process by which particles larger than 0.5 m in diameter, such as microorganisms, foreign substances, and apoptotic cells, are ingested and eliminated. Phagocytosis is found in many different types of cells and is thus an important process for tissue homeostasis.

Learn more about " Phagocytosis  " to visit here;

https://brainly.com/question/11667538

#SPJ4

What is the process of RNA synthesis called?.

Answers

Transcription is the process of creating RNA from the genetic information contained inside DNA. RNA polymerases are the enzymes involved in transcription.

Nuclear RNA polymerases come in three varieties in eukaryotes and one kind in prokaryotes.

A core enzyme and a supporting protein component known as sigma make up the bacterial RNA polymerase (s factor). Four subunits make up the core, two of which are identical (a) and two of which are similar (b and b'). The b subunit binds the nucleotides that will be connected to form the RNA molecule, while the b' subunit attaches the DNA. Sigma factors work to detect particular DNA sequences referred as as promoters. Promoters are locations where RNA polymerase is instructed to start transcription.

To learn more about RNA synthesis click here:

https://brainly.com/question/23893838

#SPJ4

The leaves of a plant appear green because chlorophyll a. reflects blue light b. absorbs blue light c. reflects green light d. absorbs green light

Answers

Chlorophyll can absorb blue-violet and red regions of the visible spectrum when they photosynthesize using light. Since green is the color in which chlorophyll could not absorb, green light is reflected. As a result, the leaves of plant appear green.

what is chlorophyll?

Chlorophyll is pigment that gives plants their green color, and it helps plants create their own food through photosynthesis

It allow plants to absorb energy from light. Chlorophyll is responsible for green color of many plants and algae

In plants, chlorophyll is major photosynthetic pigment. The chloroplast contains great number of the chlorophyll pigments to absorb light energy. Some plants grow shoot that is green throughout. Examples are herbs that have abundant chlorophyll pigments not just in leaves but also on stems.

The green pigment chlorophyll is located within the thylakoid membrane, and space between the thylakoid and the chloroplast membranes is called stroma

learn more about chlorophyll at

https://brainly.com/question/18606966

#SPJ4

How does human life depend on mitosis?.

Answers

Answer:

Role of mitosis in Humans:

1. They aid in high cell number, often known as growth.

2. They aid in healing damaged cells or regeneration of cells in cuts or  wounds.

3. Mitosis ensures genetic stability in freshly created cells.

Explanation:

Mitosis is the mechanism by which the daughter cells that are genetically identical to the parent cells are produced. The cell clones - or replicates - its chromosomes, then evenly divides the replicated chromosomes to ensure that each daughter cell has a complete set.

Your body has trillions of cells (thousands of millions). However, you began life as a single cell - a fertilized egg cell. This cell is then divided and divided again to produce other cells in a process known as mitosis.

Mitosis is a process that produces additional cells that are genetically identical to the original cell. It is essential for the development of embryos, as well as for the growth and development of human bodies. Mitosis is the process through which new cells are formed and old, destroyed, or damaged cells are replaced.

A cell splits into two identical daughter cells during mitosis. Because the daughter cells must have a copy of every chromosome, the process commences by duplicating the chromosomes and then meticulously segregating the copies to provide each new cell with a complete set.

Learn more:

https://brainly.com/question/1186551

A colostomy is the surgical creation of an artificial opening between the colon and the body surface

Answers

True, a colostomy is the surgical creation of an artificial opening between the colon & the body surface.

What exactly is a colostomy?

A colostomy is surgery that involves bringing a portion of the large intestine (the colon) to the surface of the body to produce a stoma, which is an artificial opening on the exterior of the abdomen (tummy). The waste from the colon is subsequently collected with the use of a tiny bag known as a stoma pouch.

The colon is the first one to one and a half metres of your big intestine. It collects water and nutrients from your faeces and excretes the remainder to the rectum.

If your colon, rectum, or anus do not function correctly, surgery can establish a new mechanism for your body to eliminate waste. The stoma of a colostomy allows faeces and gas to exit your body.

To learn more about colostomy follow the given link: https://brainly.com/question/28084644

#SPJ4

Complete question:

True or False.

A colostomy is the surgical creation of an artificial opening between the colon & the body surface.

True, a colostomy is the surgical creation of an artificial opening between the colon & the body surface.

What exactly is a colostomy?

A colostomy is surgery that involves bringing a portion of the large intestine (the colon) to the surface of the body to produce a stoma, which is an artificial opening on the exterior of the abdomen (tummy). The waste from the colon is subsequently collected with the use of a tiny bag known as a stoma pouch.

The colon is the first one to one and a half metres of your big intestine. It collects water and nutrients from your faeces and excretes the remainder to the rectum.

If your colon, rectum, or anus do not function correctly, surgery can establish a new mechanism for your body to eliminate waste. The stoma of a colostomy allows faeces and gas to exit your body.

To learn more about colostomy follow the given link: brainly.com/question/28084644

#SPJ4

Complete question:

State whether the given statement is True or False.

A colostomy is the surgical creation of an artificial opening between the colon & the body surface.

What eats clams eat?.

Answers

Clams are preyed upon by a wide variety of fish, including catfish, carp, and sunfish, as well as by birds, crayfish, and frogs.

Clams are consumed by a number of species, including otters, raccoons, and muskrats. Clams are a common food source for animals. They are enjoyed by fish and shorebirds alike, who occasionally crack them open by dropping them from a high height upon boulders. They are consumed by starfish by using their strong arms to pry them open.

In their shared home with clams, moon snails feed voraciously. They locate clams, perhaps through chemoreception, and then enclose them with their large foot, frequently dragging them deeper into the sand.

Shark eyes are another name for lobe-tailed moon snails. Both species are carnivores that eat other mollusks such mussels, moon snails, hard clams, razor clams, and surf clams. They begin by using their foot to wrap around their prey.

To learn about clam

#SPJ4

The complete question is

What snail eats clam ?

Which element is responsible for bone growth?

Answers

Answer: Calcium

Explanation:

The atmosphere is made up of four different layers: the thermosphere, mesosphere, stratosphere, and troposphere. Which of the following is NOT true regarding the composition and structure of the the atmosphere?

Answers

The statement that is not true regarding the composition and structure of the atmosphere is:

The stratosphere is warmer at the top than at the bottom.

The correct option is B.

What is the atmosphere?

The layer of gases collectively referred to as air that is kept by Earth's gravity and forms the planet's planetary atmosphere is known as the atmosphere of Earth.

The layers of the four atmospheres are:

the thermospheremesospherestratosphere, andtroposphere.

The mesosphere lies between the thermosphere and the stratosphere.

The troposphere is the lowest layer of Earth's atmosphere.

The thermosphere is the atmospheric region from ∼85 to ∼500 km altitude

The stratosphere is cooler at the top than at the bottom.

Learn more about layers of the atmosphere at: https://brainly.com/question/19260619

#SPJ1

Complete question:

The atmosphere is made up of four different layers: the thermosphere, mesosphere, stratosphere, and troposphere. Which of the following is NOT true regarding the composition and structure of the atmosphere?

The thermosphere is the atmospheric region from ∼85 to ∼500 km altitude

The stratosphere is warmer at the top than at the bottom.

The mesosphere lies between the thermosphere and the stratosphere.

The troposphere is the lowest layer of Earth's atmosphere.

HELPPP PLEASE!!
Research methods of psychology and write a paragraph

Answers

One of the most prevalent approaches to learn what people believe and one of the most used research techniques in psychology are surveys.

How do you write a psychology paragraph?

You must state your case succinctly and with clarity. There should be no superfluous words in a sentence and no superfluous phrases in a paragraph. Each paragraph should have a purpose or subject and make several points, each of which should be backed up by solid data.

Psychology is the name given to the scientific study of the mind and behavior. Psychologists are actively interested in researching and comprehending how the mind, the brain, and behavior work. The instruments and procedures used in research are what psychologists use to actually answer research questions.

To know more about psychology, visit:

https://brainly.com/question/12011520

#SPJ1

Where is the brachial vein located ?

Answers

The brachial vein is located in the upper limb. It is a deep vein that runs alongside the brachial artery, which is the major blood vessel that supplies blood to the arm.

The brachial vein begins at the elbow, where it collects blood from the smaller veins in the forearm, and it continues upward to the shoulder where it joins the axillary vein to form the subclavian vein. The brachial vein is important for returning oxygen-poor blood from the upper limb back to the heart, where it can be oxygenated and recirculated throughout the body. Additionally, the brachial vein is used as a site for venipuncture, a medical procedure in which a needle is inserted into the brachial vein to draw blood samples or administer medication.

Learn more about brachial vein here:

https://brainly.com/question/26551054

#SPJ4

yeasts can perform both aerobic respiration and fermentation. in fact, the homebrewer must be careful that oxygen is not introduced into the carboy once the yeast begin fermentation. what would be the products if o2 is allowed to enter the carboy?

Answers

Beer would be the product if oxygen is allowed to enter the carboy.

Brewing beer at home requires careful control of oxygen levels in the carboy.

If oxygen is allowed to enter the carboy after the yeast have begun fermentation, it can have a major impact on the final product.

Yeast can perform both aerobic respiration and fermentation, and the introduction of oxygen during fermentation can result in a beer that is less flavorful, cloudy, and has a shorter shelf life.

To ensure a great tasting and long-lasting beer, it is important to be mindful of oxygen levels and avoid introducing oxygen after fermentation has begun.

To learn more about fermentation, click here:

https://brainly.com/question/13050729

#SPJ4

Did Jamie cheat on Claire with Malva?.

Answers

Claire and Jamie stop having children after Brianna. By the end of the second season/book, Claire is walking across the stones while carrying Brianna.

Faith Fraser, Claire and Jamie's firstborn, passed away while still in the womb. She gave birth in Paris, France, following a precarious pregnancy. She was laid to rest in the Hospital des Agnes cemetery by Mother Hildegarde. Faith was the stillborn child in France. Jamie was never allowed to meet Mother Hildegarde, who baptized the child despite it being against the law. While he was in the Bastille, Claire was on the verge of passing away from childbed fever. Master Raymond rescued her from that. Brianna was born in 1948, despite being conceived in 1746. Brianna didn't discover the truth until after Frank had passed away, but she was the child Frank would raise for the length of her youth as his own.

Learn more about Jamie here:

https://brainly.com/question/30099448

#SPJ4

product remaining after the animal carcass has been processed

Answers

In actuality, carcass animal products can serve as the foundation for a wide range of other items, including soaps, paints, candles, plastics, and rubber goods.

There is zero chance that any bacteria or viruses will remain in the processed carcasses because all animal by-products are sterilized at extremely high temperatures.

To ensure thorough bleeding and ease of evisceration, animals should be kept off food for 12 to 24 hours before to slaughter while still having access to water (the removal of internal organs). Livestock are held in a chute that restricts their ability to move as the killing process gets underway.

Pre-slaughter handling, stunning, and slaughtering are the three separate steps involved in killing animals. The Humane Slaughter Act mandates that animals in the United States be treated humanely at each of these steps. meat processing; the fundamental slaughtering process.

To know more about carcass animal

https://brainly.com/question/9071405

#SPJ4

Can you make RNA in a lab?.

Answers

The capacity to reproduce itself is a basic characteristic of life. Now, scientists have developed the first ribonucleic acid molecules, a single-stranded relative of deoxyribose nucleic acid, that can replicate practically any other RNA.

A ribozyme called RNAP, also known as an all-RNA variant of RNAP, was developed in 1993 by researchers. It linked two short strands of RNA on a different template strand. The issue with all of these RNAP ribozymes is that they can only duplicate particular sequences of nucleotide bases, the components of RNA and DNA, and those sequences serve no significant functions in living cells. In order to encode the initial RNAP ribozyme, Joyce along with his assistant began by synthesizing a sizable library of DNA strands. To ensure that each of the final RNAPs was unique, they altered the DNA sequence at random. These RNAPs were included in a vial of short segments of RNA that the researchers wished to connect together on another template strand. The new strand would indicate RNAP ribozyme success by attaching to a particular molecular target in its vial if the new RNA was effectively produced. The team was able to identify any successes since each RNAP ribozyme was designed to stay attached to its unique, produced RNA strand. Then, a new round of evolution was initiated using each captured RNAP ribozyme as the starting point. The result of this test tube evolution, which took 24 rounds, was an RNAP ribozyme known as 24-3 polymerase. During this process, the scientists gradually raised the standards for what an effective RNAP ribozyme had to perform. The presence of specific RNAs could be amplified 10,000-fold by the 24-3 polymerase thanks to its capacity to duplicate previously duplicated RNAs. The polymerase chain reaction, a method extensively employed to replicate DNA, was given the first RNA version as a result.

To know more about the polymerase chain reaction click here,

https://brainly.com/question/28502368

#SPJ4

Please help due tmr afternoon

Answers

The picture is very blurry but in DNA C pairs with G and A pairs with T.
In both mRNA and tRNA T is replaced with U. So when transcribing from DNA to mRNA C still pairs with G but A now pairs with U.
The code for DNA is likely to be similar to tRNA.
Hope this helps :)

In three to five sentences, describe how the diagram of Earth's carbon cycle demonstrates the interactions among the biosphere (plants), the lithosphere (ground), the atmosphere (air), and the hydrosphere (water). CARBON CYCLE photosynthesis animal organic respiration carbon decaying organisms CO₂ ocean uptake dead organisms and waste products plant respiration root respiration fossils and fossil fuels factory and vehicle emissions mineral carbon​

Answers

ates

The diagram of Earth's carbon cycle demonstrates the interconnectedness of the biosphere, lithosphere, atmosphere, and hydrosphere. Carbon is cycled between these four components through processes such as photosynthesis, respiration, and decay. For example, plants absorb carbon dioxide from the atmosphere and release oxygen, while animals respire and release carbon dioxide. Carbon is also exchanged between the lithosphere and hydrosphere through processes such as ocean uptake and root respiration. Finally, human activities such as burning fossil fuels and factory and vehicle emissions add carbon dioxide to the atmosphere.

The mutation shown here causes ____.
A. nucleotide syndrome
B. abnormally high intelligence
C. replication disease
D. fragile X syndrome

Answers

The mutation shown here causes fragile X syndrome. The correct option is D.

What is fragile X syndrome?

A genetic disorder called fragile X syndrome results in a variety of developmental issues, such as cognitive decline and learning impairments.

Typically, this condition affects men more severely than it does women. By the age of 2, most affected people have delayed speech and language development.

FXS is a hereditary condition known as fragile X syndrome. A gene called Fragile X Messenger Ribonucleoprotein 1 alterations lead to FXS (FMR1).

A protein termed FMRP that is required for brain development is typically produced by FMR1. FXS patients cannot produce this protein.

Intellectual difficulties, physically distinctive traits of the syndrome, behavioral difficulties, speech and language difficulties, and sensory abnormalities are among the symptoms shared by people with fragile X.

Thus, the correct option is D.

For more details regarding fragile X syndrome, visit:

https://brainly.com/question/281727

#SPJ1

characteritics if genetic code

Answers

Answer:

genetic code, the sequence of nucleotides in deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) that determines the amino acid sequence of proteins. Though the linear sequence of nucleotides in DNA contains the information for protein sequences, proteins are not made directly from DNA.

B lymphocytes produce antibodies when they are activated by :

Answers

Answer:

Bacterium.

Explanation:

Lymphocytes produce antibodies that fight and kill bacteria.

Which i an abiotic factor?
O A) fungi and mo on a rotting log
O B) a foret of deciduou tree
O C) a polar bear on an ice floe
O D) an ocean current of cold water

Answers

An ocean current of cold water is the abiotic factor. Abiotic factor is define as the non-living components.

Abiotic factors are non-living components of an ecosystem that influence their surroundings. Examples could be light, water, and temperature in a terrestrial habitat. Abiotic elements in a marine ecosystem include salinity and ocean current.

The living species that directly or indirectly affect other organisms in an environment are referred to as biotic components. For instance, consider plants, animals, bacteria, and the waste products they produce. The non-living, or abiotic, aspects of an ecosystem include all chemical and physical substances.

So, the fungi mould on the rotting log, a forest of deciduous tree, a polar bear on an ice floe are biotic factors. and An ocean current of cold water is abiotic factor.

For more such questions on Abiotic components, Visit: brainly.com/question/12689972

#SPJ4

What is the main aim of the scientific method in the research field Mcq?.

Answers

The goal of scientific research is often to come up with testable explanations that may be used to forecast the outcomes of upcoming trials. All scientific approaches have the same objective, which is to analyze the initial observation. 

The reproducibility of the scientific method is one of its key characteristics. A functioning hypothesis' experiments must be meticulously documented in order for others to duplicate them and eventually lead to the hypothesis' acceptance. The scientific method is intended to offer clear processes for analytically responding to a research question. The first step in the scientific process is for scientists to make observations regarding the problem at hand. Following that, they investigate what is already known about the subject and develop a hypothesis to address their query.

To know more about the research please visit

https://brainly.com/question/24174276

#SPJ4

The use of empirical evidence, or proof through observation or experiment, to confirm or disprove theories and hypotheses.

Individual viewpoints and beliefs on the final result. Replicability: The capacity of other researchers to reproduce the investigation and produce comparable outcomes, so confirming the veracity of the conclusions. Parsimony is the practice of relying on the most straightforward explanation that makes sense of the data rather than more complicated or improbable ones. Through peer review and replication, the scientific community has the capacity to recognize and address mistakes or inconsistencies in the research. In conclusion, scientific research is distinguished by its reliance on empirical data, objectivity in methodology, replication, parsimony, and self-correction, all of which contribute to the validity and reliability of the results.

Learn more about Parsimony here:

https://brainly.com/question/30336884

#SPJ4

is the primary link between the endocrine and nervous systems.

Answers

The endocrine,brain and neurological systems are connected via the hypothalamus.

Your brain's hypothalamus is a structure located there. It serves as the primary connection between your neurological system and endocrine system. Your body maintains homeostasis, a stable state of equilibrium, thanks to the hypothalamus. The hypothalamus, which regulates communication between the neurological and endocrine systems via chemical messengers, interacts with both of these systems.The endocrine,brain and neurological systems are connected via the hypothalamus. They both play a vital role in maintaining the body's functionality and ability to respond appropriately to stimuli. Although not directly, there are nevertheless significant interactions with the nervous system. The pituitary gland, which regulates the production of hormones in the body, is controlled by the hypothalamus, which connects the two.

Learn more about brain

https://brainly.com/question/2664243

#SPJ4

Why did Darwin use the Galapagos Islands as the main source of his research?.

Answers

The islands are noted for having an enormous range of rare species. On these islands, Darwin began formulating his evolutionary theory. The same kind of animal varied from one island to the next, according to Darwin, who observed this in the Galápagos.

The ship made a halt at the Galapagos Islands after examining South America's coastlines. When Darwin visited the islands, he saw that the rare species were similar from island to island but perfectly adapted to their environs, which made him wonder where the occupants of the islands had come from.

The finches that bear his name today are among those that moved Darwin so deeply. Darwin later used the supposition that these finches were all descended from the same ancestry to inform some of his theories.

To know more about evolutionary theory

brainly.com/question/6111443

#SPJ4

distinguish between the actions of excitatory and inhibitory neurotransmitters

Answers

An excitatory transmitter stimulates the production of an electrical signal known as an action potential in the receiving neuron, whereas an inhibitory transmitter inhibits it.

The receptor to which a neurotransmitter binds determines whether it is excitatory or inhibitory.

Neuromodulators are distinct in that they are not limited to the synaptic cleft between two neurons and can thus affect a large number of neurons at once. As a result, neuromodulators regulate populations of neurons while operating at a slower rate than excitatory and inhibitory transmitters.

The majority of neurotransmitters are small amine molecules, amino acids, or neuropeptides. There are approximately a dozen small-molecule neurotransmitters and more than 100 different neuropeptides known, and neuroscientists are still learning more about these chemical messengers. These chemicals and their interactions are involved in numerous nervous system functions as well as controlling bodily functions.

Learn more about " neurotransmitter binds  " to visit here;

https://brainly.com/question/28305195

#SPJ4

DNA Never leaves the Nucleus of the cell. This is why you need RNA. In Transcription, DNA is
transcribed into a strand of RNA.
DNA has Adenine, Thymine, Cytosine, Guanine
RNA has Adenine, Uracil, Cytosine, Guanine
Transcription of DNA to RNA
ATGCCTAAGCCGTGTCCGAT

Answers

Answer:

Transcription and translation are the processes by which cells read or express the genetic instructions encoded in their DNA. Because multiple identical RNA copies may be produced from the same gene, and each RNA molecule can drive the creation of many similar protein molecules, cells can swiftly create a vast amount of protein when needed. However, each gene may be transcribed and translated with varying degrees of effectiveness, allowing the cell to produce massive amounts of some proteins while producing minute amounts of others (Figure 6-3). Furthermore, as we will learn in the following chapter, a cell may adjust (or regulate) the expression of each of its genes based on the demands of the moment—most visibly by managing RNA synthesis.

what would be the dependent and independant variable

Answers

Both dependent and independent variable are found in an experiment.

What is  dependent and independent variable?

An independent variable is a variable that is being manipulated in an experiment or study to observe its effects on another variable. The independent variable is changed by the researcher to determine its impact on the dependent variable.

A dependent variable is a variable that is being measured or observed in an experiment or study in response to changes in the independent variable. The value of the dependent variable depends on the value of the independent variable. It is the variable being affected by the changes made to the independent variable.

Learn more about independent variable:https://brainly.com/question/29430246

#SPJ1

What is the major concept of the biological theory of evolution?.

Answers

All species are connected and change gradually through time, according to the theory of evolution. The  genetic diversity supports evolution in a population that has an impact on an organism's phenotypic features. 

It is a shift in a set of organisms' characteristics across several generations. It includes everything from minute variations in the ratios of various gene types within a population to the modifications that resulted in the evolution of the earliest organism into dinosaurs, bees, oak trees, and humans. The earth's current species evolved from earlier, distinctly different species. In the natural world, individuals with specific mutations may have a higher chance of surviving the struggle for survival and procreating. If so, they would pass down any advantageous modifications to their progeny.

To know more about evolution please visit

https://brainly.com/question/29351017

#SPJ4

Other Questions
Which of the following statements about price is false?a. Price captures what customers are willing to pay to acquire a product.b. Price and demand usually rise and fall together.c. Price is the amount of money marketers charge for their products or services.d. Price represents the sum of ALL values customers must give-up (exchange) in order to get benefits associated with having or using products or services.e. All preceding statements are actually true describe the process of triangulation to locate an epicenter. What does the poet want to compare in the line continuous as the stars that shine?. What was the main reason for the Glorious Revolution in 1688 89?. Write a possible equation for a cosine function that has a maximum point at (1, 11) and a minimum point at (8, 3). when surveyed in 2019, about how many terps said that they had 0 sexual partners in the past 12 months? When consumers substitute a cheaper good for a more expensive one, the CPI will ______ the change in the cost of living full faith and credit clause definition government PracticeNotebook Respond to these questions.1. (a) What happens to Nivea's household when Uncle Marcos visits? Cite detailsthat support your response. (b) What does his effect on the household tell youabout Uncle Marcos's character? What seemed to cause conflict between Persia and Athens Complete the answers to these questions about future transportation using the correct form of the words in parentheses A student says that (0,1) is a solution to the following system of inequalities. y > x y >2x + 1 She says that (0, 1) is a solution because it is a solution of y > x. How many types of epic are there?. identify whether each of the following activities takes place in the markets for goods and services or markets for factors of production. What does the word ditties in the poem mean?. You want to pass a bicyclist in a narrow traffic lane when an oncoming vehicle is approaching. You should:a. Honk your horn then pass the bicyclist.b. Slow down and let the vehicle pass you before you pass the bicyclist.c. Wait until the bicyclist rides off the roadway. For the following acid-base reaction, predict the position of the equilibrium and identify the most acidic compound.O favor the right side with compound I being the most acidic compound O favor the right side with compound III being the most acidic compound O favor the left side with compound I being the most acidic compound O favor the left side with compound III being the most acidic compound O the reaction is at equilibrium so all the compounds are in equal concentration What will you do before reading the story?. Missy diwater, the former platform diver for the ringling brother's circus, had a kinetic energy of 12 000 j just prior to hitting the bucket of water. If missy's mass is 40 kg, then what is her speed?. Whats 3/5 - 1/10 in fractions