The hippocampus processes explicit memories as opposed to implicit memories.
The correct option is b.
Declarative memory, also known as explicit memory, refers to conscious long-term memory that can be quickly and consciously recalled and recited. Implicit memory, which is a deceptive, unconsciously held kind of memory, contrasts with it.
Through a process of encoding and retrieval, explicit memories are created. The information is "recorded" in the brain during the encoding phase.
The brain's temporal lobe contains the hippocampus, where memories are "created." The hippocampus binds neurons together, bringing all the many pieces of information in the memory together (the music, the smells, the colors, etc.).
Flashcards, vocal repetition, revisiting photos, and other techniques can be used to consciously code explicit memories. The hippocampus receives repeated exposure to memories when someone practises them. Recalling rehearsed memories is frequently simpler in the future.
To learn more about explicit memories, refer
https://brainly.com/question/4462712
#SPJ4
what part of the nervous system contains the brain and spinal cord; processes, stores and responds to information from the peripheral nervous system?
Central nervous system contains the brain and spinal cord processes, stores and responds to information from the peripheral nervous system.
In general, the central nervous system's is responsible for receiving, processing, and responding to all sensory information. They take help of peripheral nervous that is composed of nerves that branch off from the spinal cord and extend to all parts of the body.
Hence, brain and the spinal cord are enclosed and protected by bone brain is covered by bones of the skull, and the spinal cord inside a set of ring-shaped bones called vertebrae. They both are having cushioned layers that is also called meninges and a special fluid called cerebrospinal fluid.
To learn more about Central nervous system , here
brainly.com/question/29974261
#SPJ4
What are the characteristics of a visceral reflex? Select all that apply.
-Voluntary
-Automatic
-Stereotyped
-Conscious
-Unconscious
-Unpredictable
Unconscious, Stereotyped and Automatic are the characteristics of a visceral reflex. reflex can be from birth or it may come in between.
Both visceral and somatic reflexes are possible. In visceral responses, internal organs like the heart, blood vessels, or GI tract structures respond glandurally or non-skeletally. For the purpose of eliciting their behaviours, they use neurons in the autonomic nervous system. The section on the autonomic nervous system has covered visceral reflexes in further detail. Somatic reflexes, on the other hand, entail motor reactions from the skeletal muscles that are not conscious. These reflexes accomplish so by using a few of the same lower motor neurons (alpha motor neurons) that are responsible for controlling skeletal muscle during conscious movement. Given how quickly they work, somatic reflexes make sense in that they frequently serve to keep us safe from harm.
learn more about visceral reflex here
https://brainly.com/question/29727145
#SPJ4
what would be the dependent and independant variable
Both dependent and independent variable are found in an experiment.
What is dependent and independent variable?An independent variable is a variable that is being manipulated in an experiment or study to observe its effects on another variable. The independent variable is changed by the researcher to determine its impact on the dependent variable.
A dependent variable is a variable that is being measured or observed in an experiment or study in response to changes in the independent variable. The value of the dependent variable depends on the value of the independent variable. It is the variable being affected by the changes made to the independent variable.
Learn more about independent variable:https://brainly.com/question/29430246
#SPJ1
HELPPP PLEASE!!
Research methods of psychology and write a paragraph
One of the most prevalent approaches to learn what people believe and one of the most used research techniques in psychology are surveys.
How do you write a psychology paragraph?You must state your case succinctly and with clarity. There should be no superfluous words in a sentence and no superfluous phrases in a paragraph. Each paragraph should have a purpose or subject and make several points, each of which should be backed up by solid data.
Psychology is the name given to the scientific study of the mind and behavior. Psychologists are actively interested in researching and comprehending how the mind, the brain, and behavior work. The instruments and procedures used in research are what psychologists use to actually answer research questions.
To know more about psychology, visit:
https://brainly.com/question/12011520
#SPJ1
How will the offspring be affected if one of the gametes carry an impaired number of haploid chromosomes?.
The offspring will suffer if one of the gametes or one of the parents has an abnormally low number of haploid chromosomes. This may result in a number of different genetic problems.
Trisomy occurs when a gamete with two copies of a chromosome fuses with a normal gamete during fertilization; monosomy occurs when a gamete with no copies of a chromosome fuses with a normal gamete during fertilization. In both humans and other animals, autosomal monosomy usually results in death.
Normally, the gamete or zygote will be discarded. It will either die shortly after birth or be susceptible to various genetic changes if it survives the gestation period. In sexually reproducing animals, the gametes have half as many chromosomes as the parents do.
Learn more about gametes :
brainly.com/question/2569962
#SPJ4
A colostomy is the surgical creation of an artificial opening between the colon and the body surface
True, a colostomy is the surgical creation of an artificial opening between the colon & the body surface.
What exactly is a colostomy?A colostomy is surgery that involves bringing a portion of the large intestine (the colon) to the surface of the body to produce a stoma, which is an artificial opening on the exterior of the abdomen (tummy). The waste from the colon is subsequently collected with the use of a tiny bag known as a stoma pouch.
The colon is the first one to one and a half metres of your big intestine. It collects water and nutrients from your faeces and excretes the remainder to the rectum.
If your colon, rectum, or anus do not function correctly, surgery can establish a new mechanism for your body to eliminate waste. The stoma of a colostomy allows faeces and gas to exit your body.
To learn more about colostomy follow the given link: https://brainly.com/question/28084644
#SPJ4
Complete question:
True or False.
A colostomy is the surgical creation of an artificial opening between the colon & the body surface.
True, a colostomy is the surgical creation of an artificial opening between the colon & the body surface.
What exactly is a colostomy?A colostomy is surgery that involves bringing a portion of the large intestine (the colon) to the surface of the body to produce a stoma, which is an artificial opening on the exterior of the abdomen (tummy). The waste from the colon is subsequently collected with the use of a tiny bag known as a stoma pouch.
The colon is the first one to one and a half metres of your big intestine. It collects water and nutrients from your faeces and excretes the remainder to the rectum.
If your colon, rectum, or anus do not function correctly, surgery can establish a new mechanism for your body to eliminate waste. The stoma of a colostomy allows faeces and gas to exit your body.
To learn more about colostomy follow the given link: brainly.com/question/28084644
#SPJ4
Complete question:
State whether the given statement is True or False.
A colostomy is the surgical creation of an artificial opening between the colon & the body surface.
How does the atomic number affect the elements properties?.
Chemical properties of an element are determined by its atomic number. Bonding and other chemical properties are determined by the number of electrons in an atom. The number of electrons in a neutral atom is equal to the atomic number Z.
A nucleus and electrons that orbit the latter make up an atom. The number of protons (atomic number) in the nucleus, which consists of protons with a positive charge and neutrons without a charge, defines the chemical composition of the atom (element type). Each element has special qualities all its own. Each has a unique atomic number and mass number due to the varied amounts of protons and neutrons it contains.
Learn more about Atomic Number
brainly.com/question/13464692
#SPJ4
more than normal aging understanding mild cognitive impairment
Normal ageing and minor cognitive impairment are unquestionably two different things.
In general, moderate cognitive impairment refers to when a person exhibits observable symptoms of changes in their memory or way of thinking but is still able to carry out daily tasks. Mild cognitive impairment (MCI) is the stage that occurs between the normal aging-related decrease in memory and thinking and the more severe dementia-related decline. Problems with memory, language, or judgement may be a symptom of MCI. However, in general, the signs of cognitive deterioration brought on by ageing include: slower problem-solving and inductive thinking, reduction in spatial orientation, the slowing down of perception. From 6.7% of 60 to 64-year-olds to more than 25% of 80 to 84-year-olds, the prevalence of MCI increases with age.
To learn more about symptoms click here https://brainly.com/question/29628193
#SPJ4
has an anticodon on one end and an amino acid on the other end?
An anticodon is a trinucleotide sequence that is complementary to a corresponding codon in a messenger RNA (mRNA) sequence and is found at one end of a transfer RNA (tRNA) molecule.
What contains both an anticodon and an amino acid?
The amino acids that tRNAs deliver to the mRNA are delivered in a specific order. This order is established by an attraction between a codon, which is a three-nucleotide sequence on the mRNA, and an anticodon, which is a complementary triplet of nucleotides on the tRNA.
What possess an anticodone and carries an amino acid?
Each tRNA contains the anticodon for a specific mRNA codon and carries the amino acid corresponding to that codon to the ribosomes during translation.
To know more about amino acid visit:-
brainly.com/question/28409615
#SPJ4
In animal cells, a pair of small cylindrical structures composed of microutubules that duplicate during interphase and move to opposite ends of the cell during prophase.
Answer: Those would be the centrioles, where spindle fibers are released during metaphase.
Hope this helps :)
Explanation:
DNA Never leaves the Nucleus of the cell. This is why you need RNA. In Transcription, DNA is
transcribed into a strand of RNA.
DNA has Adenine, Thymine, Cytosine, Guanine
RNA has Adenine, Uracil, Cytosine, Guanine
Transcription of DNA to RNA
ATGCCTAAGCCGTGTCCGAT
Answer:
Transcription and translation are the processes by which cells read or express the genetic instructions encoded in their DNA. Because multiple identical RNA copies may be produced from the same gene, and each RNA molecule can drive the creation of many similar protein molecules, cells can swiftly create a vast amount of protein when needed. However, each gene may be transcribed and translated with varying degrees of effectiveness, allowing the cell to produce massive amounts of some proteins while producing minute amounts of others (Figure 6-3). Furthermore, as we will learn in the following chapter, a cell may adjust (or regulate) the expression of each of its genes based on the demands of the moment—most visibly by managing RNA synthesis.
5. Describe how a warming climate could affect baby Ringed Seals.
Did Jamie cheat on Claire with Malva?.
Claire and Jamie stop having children after Brianna. By the end of the second season/book, Claire is walking across the stones while carrying Brianna.
Faith Fraser, Claire and Jamie's firstborn, passed away while still in the womb. She gave birth in Paris, France, following a precarious pregnancy. She was laid to rest in the Hospital des Agnes cemetery by Mother Hildegarde. Faith was the stillborn child in France. Jamie was never allowed to meet Mother Hildegarde, who baptized the child despite it being against the law. While he was in the Bastille, Claire was on the verge of passing away from childbed fever. Master Raymond rescued her from that. Brianna was born in 1948, despite being conceived in 1746. Brianna didn't discover the truth until after Frank had passed away, but she was the child Frank would raise for the length of her youth as his own.
Learn more about Jamie here:
https://brainly.com/question/30099448
#SPJ4
genes that are likely inherited together due to their physical proximity is called ?
Genetic linkage describes a group of genes that are likely to inherit together because they are close together.
The alleles of genes that are together on a chromosome are more likely to be handed down as a pair. Genes that are sufficiently close to one another on a chromosome have a propensity to "remain together." The phrase for this phenomenon is genetic linkage.
Physical proximity between two genetic markers makes it less difficult for them to be split off onto distinct chromatids during chromosomal crossover, and as a result, they are considered to be more connected than markers that are physically far apart.
In other words, the lower the likelihood of recombination between two genes, and the higher the likelihood that they will be inherited together, the closer they are to one another on a chromosome.
To learn more about Genetic linkage, refer
https://brainly.com/question/22173626
#SPJ4
The human body contains as many as 1 ______ neurons.
The human body contains as many as 1 trillion neurons. A neuron, also known as a nerve cell, is the fundamental unit of the nervous system.
How many neurons are in the human body?Azevedo and others found that the average adult male brain weighs 1.5 kg and has 86 billion neurons and 85 billion semi cells, which are only 7 and 24% less than expected.
Is there more than one cell body in a neuron?Parts that make up a neuron. Like other cells, each has a soma, or cell body, that contains the nucleus, smooth and rough reticulum, Golgi, mitochondria, and other cellular components.
How many neurons are produced each day?During adulthood, your hippocampus actually produces approximately 1400 neurons per day of new brain cells. This was first noticed by scientists in the 1960s, but the idea that the adult brain could make new neurons (called neurogenesis) wasn't widely accepted until the 1990s and remained contentious for decades.
Incomplete question :
The human body contains as many as 1 ___ neurons.
a) million
b) billion
c) hundred thousand
d) trillion
Learn more about Neurons :
brainly.com/question/13061744
#SPJ4
The sodium-potassium pump is involved in establishing the resting membrane potential.T/F
True. A resting membrane potential is established by the sodium-potassium pump.
How does a membrane potential get established by the sodium-potassium pump?The Na+/K+ pump converts three internal Na+ ions into two external K+ ions using the energy with one ATP molecule (Glitsch, 2001).As a result, the pumps is electrogenic and hyperpolarizes the membrane potential by extruding 1 net charge every cycle.
What function would the Na +- K+ pumps have in ion flow?The Na+/K+-pump is indeed an active transporter it moves both ions across the nerve cell membrane against concentration gradients using ATP hydrolysis as just an energy source. It performs specialized tasks related to the production of the nerve impulse as well as the upkeep of other active transport.
To know more about membrane visit:
https://brainly.com/question/26872631
#SPJ4
Describe what will happen next after the neurotransmitter binds to the afferent neuron.
which characteristic is a strength of epidemiological studies?
The characteristic strength of epidemiological studies are that it can narrow down the list of possible causes and raise questions to pursue through other types of studies.
Epidemiological studies refers to the research based study which helps in identification and distribution of specific diseases in a given population. Epidemiology involves collection of data, and a systematic study through which relations and its effect are set. The population is selected through survey and no random sampling is done. It is important to know about the disease and the kind of population taken in the study before actually performing any research/ experiment. The major disadvantage of this study is lack of control on the variables whose effect or value may change with the changing environment.
Learn more about epidemiological studies at:
brainly.com/question/28238114
#SPJ4
Where are ADA enzymes?.
Adenosine deaminase is produced using instructions from the ADA gene.
All cells produce this enzyme, but the immune system's lymphocytes—which form in lymphoid tissues—create the most adenosine deaminase. The thymus, a gland found behind the breastbone, and lymph nodes, which are present all over the body, are examples of these lymphoid structures. The immune system, which protects the body from potentially hazardous intruders like viruses and bacteria, is made up of lymphocytes.
The adenosine deaminase enzyme's job is to get rid of the deoxyadenosine molecule that is produced when DNA is broken down. Deoxyadenosine, which is hazardous to lymphocytes, is changed into the harmless deoxyinosine by the enzyme adenosine deaminase.
To learn more about ADA enzymes click here:
https://brainly.com/question/30277919
#SPJ4
What is the process of RNA synthesis called?.
Transcription is the process of creating RNA from the genetic information contained inside DNA. RNA polymerases are the enzymes involved in transcription.
Nuclear RNA polymerases come in three varieties in eukaryotes and one kind in prokaryotes.
A core enzyme and a supporting protein component known as sigma make up the bacterial RNA polymerase (s factor). Four subunits make up the core, two of which are identical (a) and two of which are similar (b and b'). The b subunit binds the nucleotides that will be connected to form the RNA molecule, while the b' subunit attaches the DNA. Sigma factors work to detect particular DNA sequences referred as as promoters. Promoters are locations where RNA polymerase is instructed to start transcription.
To learn more about RNA synthesis click here:
https://brainly.com/question/23893838
#SPJ4
The mutation shown here causes ____.
A. nucleotide syndrome
B. abnormally high intelligence
C. replication disease
D. fragile X syndrome
The mutation shown here causes fragile X syndrome. The correct option is D.
What is fragile X syndrome?A genetic disorder called fragile X syndrome results in a variety of developmental issues, such as cognitive decline and learning impairments.
Typically, this condition affects men more severely than it does women. By the age of 2, most affected people have delayed speech and language development.
FXS is a hereditary condition known as fragile X syndrome. A gene called Fragile X Messenger Ribonucleoprotein 1 alterations lead to FXS (FMR1).
A protein termed FMRP that is required for brain development is typically produced by FMR1. FXS patients cannot produce this protein.
Intellectual difficulties, physically distinctive traits of the syndrome, behavioral difficulties, speech and language difficulties, and sensory abnormalities are among the symptoms shared by people with fragile X.
Thus, the correct option is D.
For more details regarding fragile X syndrome, visit:
https://brainly.com/question/281727
#SPJ1
Which element is responsible for bone growth?
Answer: Calcium
Explanation:
Who studied inheritance of traits in pea plants?.
Gregor Mendel studied inheritance of traits in pea plants.
Mendel created three laws of inheritance that characterised the transfer of genetic features through pea plant breeding before anybody knew what genes were. Peas are readily cultivated in great quantities, and their reproduction may be controlled. Peas also have male and female reproductive organs, allowing them to self-pollinate in addition to cross-pollinate. Mendel is regarded as the father of genetics because to his seminal work on heredity in pea plants 150 years ago. Mendel launched a series of experiments just at monastery in 1856 to discover how features are handed down through the generations. It was considered at the time that the qualities of the parents were merged together in their offspring.
Mendel examined pea inheritance (Pisum sativum). He picked peas because they had previously been used in comparable trials, they are easy to cultivate, and they can be seeded every year. Pea blooms have both male and female components, known as stamen & stigma, and self-pollinate. Self-pollination occurs even before flowers open, resulting in offspring from a single plant.
To know more about the Mendel study pea plants, here
https://brainly.com/question/19601954
#SPJ4
How are ultraviolet light and the ozone layer connected?
a. Ultraviolet light destroys the ozone layer
b. Ultraviolet light and ozone are not connected
c. Ultraviolet light reactions rebuild the ozone layer
d. ultraviolet light disrupts cloud formation - limiting the ozone layer
Option a. Ultraviolet light destroys the ozone layer describes the connection of ultraviolet light and the ozone layer
Ultraviolet (UV) light is a type of electromagnetic radiation that exists in the spectrum of light between visible light and X-rays. The ozone layer is a region of the Earth's stratosphere that contains a high concentration of ozone (O3) molecules, which protects the Earth's surface from the harmful effects of UV radiation.
When UV light reaches the ozone layer, it can cause the ozone molecules to break apart, resulting in a decrease in the overall amount of ozone in the atmosphere. This process is known as ozone depletion. The destruction of ozone is caused by UV-B light and man-made chemicals such as chlorofluorocarbons (CFCs) that release chlorine and bromine atoms that are highly reactive to ozone.
Learn more about ozone layer here:
https://brainly.com/question/13253026
in 2-3 sentences, describe how the bird population changed over the 5 years of feeding and reproducing.
The bird population may have changed over the 5 years of feeding and reproducing ide to an environmental constraint that led to the increase of adaptive alleles in the new environmental conditions.
What are adaptive alleles?Adaptive alleles can be defined as gene variants that are present in the original population and they can increase their frequency in presence of a new environmental condition and or factors.
Therefore, with this data, we can see that adaptive alleles can dramatically increase the frequency in a population in response to changes in the environmental conditions.
Learn more about adaptive alleles here:
https://brainly.com/question/16103508
#SPJ1
What factors cause leaves to change color?.
Autumn leaf color is influenced by three factors:
Pigments found in leavesDuration of the nightThe weatherThe calendar controls the timing of color changes and the onset of falling leaves as the nights grow longer. None of the other environmental influences, such as temperature, rainfall, and food supply, are as consistent as the increasing length of night during autumn. As the days shorten and the nights lengthen and cool, biochemical processes in the leaf begin to paint the landscape with Nature's autumn palette.
A color palette requires pigments, and three types are present in autumn color: carotenoids, anthocyanin, and chlorophyll.
Throughout the growing season, chlorophyll and carotenoids are found in the chloroplasts of leaf cells.
To know more about leaves click here,
https://brainly.com/question/14949275
#SPJ4
Why did Darwin use the Galapagos Islands as the main source of his research?.
The islands are noted for having an enormous range of rare species. On these islands, Darwin began formulating his evolutionary theory. The same kind of animal varied from one island to the next, according to Darwin, who observed this in the Galápagos.
The ship made a halt at the Galapagos Islands after examining South America's coastlines. When Darwin visited the islands, he saw that the rare species were similar from island to island but perfectly adapted to their environs, which made him wonder where the occupants of the islands had come from.
The finches that bear his name today are among those that moved Darwin so deeply. Darwin later used the supposition that these finches were all descended from the same ancestry to inform some of his theories.
To know more about evolutionary theory
brainly.com/question/6111443
#SPJ4
Which layer of earth's atmosphere is most strongly affected by conditions on the sun's surface?.
The thermosphere layer of the earth is most affected by conditions on the surface of the sun.
What layer of the atmosphere is the sun's greatest influence on?
The thermosphere is a region where temperatures once more increase with height and is situated above the mesopause. The intense UV and X-ray radiation from the sun has been absorbed, causing this increase in temperature.
Which atmospheric layer is most impacted by the weather?
Troposphere. This region, which is frequently referred to as the lower atmosphere, is where most weather occurs. The troposphere extends from the surface of the Earth to a height of 4 to 12 miles (6 to 20 km).
To know more about thermosphere layer visit:-
https://brainly.com/question/12224909
#SPJ4
Sunlight is reflected, absorbed, and transmitted by earth's atmosphere. Which are the chief constituents of the electromagnetic energy that reaches earth's surface? select the two correct answers.
The atmosphere of Earth reflects, absorbs, and transmits solar radiation. Ultraviolet light and visible light are the main components of the electromagnetic energy that reaches the surface of the Earth.
The three main atmospheric components that absorb radiation are ozone, carbon dioxide, and water vapor. Most ultraviolet, X-, and gamma rays, which have shorter wavelengths than visible light, are absorbed by the earth's atmosphere. If high energy X- and gamma rays were to strike the earth's surface directly, the organisms and cells of beings would be harmed. The ozone layer, which is higher up in the stratosphere, absorbs solar ultraviolet radiation and influences how much heat from the sunlight is reflected back into space. We are protected by the ozone layer from the damaging effects of too much UV radiation, which can cause sunburn, skin cancer, and eye damage.
To learn more about sun light click here https://brainly.com/question/28613538
#SPJ4
The leaves of a plant appear green because chlorophyll a. reflects blue light b. absorbs blue light c. reflects green light d. absorbs green light
Chlorophyll can absorb blue-violet and red regions of the visible spectrum when they photosynthesize using light. Since green is the color in which chlorophyll could not absorb, green light is reflected. As a result, the leaves of plant appear green.
what is chlorophyll?
Chlorophyll is pigment that gives plants their green color, and it helps plants create their own food through photosynthesis
It allow plants to absorb energy from light. Chlorophyll is responsible for green color of many plants and algae
In plants, chlorophyll is major photosynthetic pigment. The chloroplast contains great number of the chlorophyll pigments to absorb light energy. Some plants grow shoot that is green throughout. Examples are herbs that have abundant chlorophyll pigments not just in leaves but also on stems.
The green pigment chlorophyll is located within the thylakoid membrane, and space between the thylakoid and the chloroplast membranes is called stroma
learn more about chlorophyll at
https://brainly.com/question/18606966
#SPJ4