Answer:
Plants growing on the forest floor (understorey) are adapted to lower Sunlight intensity or are shade loving. This is because, the dense canopy does not allow enough light to penetrate through and reach the forest floor.
A plant growing at the lower levels survive as they have large and broad leaves. The correct option is b.
What is adaptation?Evolutionary adaptation, or simply adaptation, is the process through which organisms change to their surroundings to improve their chances of surviving in those surroundings.
"Adaptation is defined as the process through which a species or an organism continuously increases its acclimation to its environment."
The term "adaptation" refers to an animal's behavioral or physical traits that enhance its capacity to flourish in its ecosystem.
In an environment with low light levels, the larger shade leaves offer a wider area for absorbing light energy for photosynthesis.
Smaller solar leaves, on the other hand, will have less surface area available for the loss of water through transpiration.
Thus, the correct option is B.
For more details regarding adaptation, visit:
https://brainly.com/question/29768035
#SPJ2
DNA Never leaves the Nucleus of the cell. This is why you need RNA. In Transcription, DNA is
transcribed into a strand of RNA.
DNA has Adenine, Thymine, Cytosine, Guanine
RNA has Adenine, Uracil, Cytosine, Guanine
Transcription of DNA to RNA
ATGCCTAAGCCGTGTCCGAT
Answer:
Transcription and translation are the processes by which cells read or express the genetic instructions encoded in their DNA. Because multiple identical RNA copies may be produced from the same gene, and each RNA molecule can drive the creation of many similar protein molecules, cells can swiftly create a vast amount of protein when needed. However, each gene may be transcribed and translated with varying degrees of effectiveness, allowing the cell to produce massive amounts of some proteins while producing minute amounts of others (Figure 6-3). Furthermore, as we will learn in the following chapter, a cell may adjust (or regulate) the expression of each of its genes based on the demands of the moment—most visibly by managing RNA synthesis.
distinguish between the actions of excitatory and inhibitory neurotransmitters
An excitatory transmitter stimulates the production of an electrical signal known as an action potential in the receiving neuron, whereas an inhibitory transmitter inhibits it.
The receptor to which a neurotransmitter binds determines whether it is excitatory or inhibitory.
Neuromodulators are distinct in that they are not limited to the synaptic cleft between two neurons and can thus affect a large number of neurons at once. As a result, neuromodulators regulate populations of neurons while operating at a slower rate than excitatory and inhibitory transmitters.
The majority of neurotransmitters are small amine molecules, amino acids, or neuropeptides. There are approximately a dozen small-molecule neurotransmitters and more than 100 different neuropeptides known, and neuroscientists are still learning more about these chemical messengers. These chemicals and their interactions are involved in numerous nervous system functions as well as controlling bodily functions.
Learn more about " neurotransmitter binds " to visit here;
https://brainly.com/question/28305195
#SPJ4
What is the process of RNA synthesis called?.
Transcription is the process of creating RNA from the genetic information contained inside DNA. RNA polymerases are the enzymes involved in transcription.
Nuclear RNA polymerases come in three varieties in eukaryotes and one kind in prokaryotes.
A core enzyme and a supporting protein component known as sigma make up the bacterial RNA polymerase (s factor). Four subunits make up the core, two of which are identical (a) and two of which are similar (b and b'). The b subunit binds the nucleotides that will be connected to form the RNA molecule, while the b' subunit attaches the DNA. Sigma factors work to detect particular DNA sequences referred as as promoters. Promoters are locations where RNA polymerase is instructed to start transcription.
To learn more about RNA synthesis click here:
https://brainly.com/question/23893838
#SPJ4
The mutation shown here causes ____.
A. nucleotide syndrome
B. abnormally high intelligence
C. replication disease
D. fragile X syndrome
The mutation shown here causes fragile X syndrome. The correct option is D.
What is fragile X syndrome?A genetic disorder called fragile X syndrome results in a variety of developmental issues, such as cognitive decline and learning impairments.
Typically, this condition affects men more severely than it does women. By the age of 2, most affected people have delayed speech and language development.
FXS is a hereditary condition known as fragile X syndrome. A gene called Fragile X Messenger Ribonucleoprotein 1 alterations lead to FXS (FMR1).
A protein termed FMRP that is required for brain development is typically produced by FMR1. FXS patients cannot produce this protein.
Intellectual difficulties, physically distinctive traits of the syndrome, behavioral difficulties, speech and language difficulties, and sensory abnormalities are among the symptoms shared by people with fragile X.
Thus, the correct option is D.
For more details regarding fragile X syndrome, visit:
https://brainly.com/question/281727
#SPJ1
more than normal aging understanding mild cognitive impairment
Normal ageing and minor cognitive impairment are unquestionably two different things.
In general, moderate cognitive impairment refers to when a person exhibits observable symptoms of changes in their memory or way of thinking but is still able to carry out daily tasks. Mild cognitive impairment (MCI) is the stage that occurs between the normal aging-related decrease in memory and thinking and the more severe dementia-related decline. Problems with memory, language, or judgement may be a symptom of MCI. However, in general, the signs of cognitive deterioration brought on by ageing include: slower problem-solving and inductive thinking, reduction in spatial orientation, the slowing down of perception. From 6.7% of 60 to 64-year-olds to more than 25% of 80 to 84-year-olds, the prevalence of MCI increases with age.
To learn more about symptoms click here https://brainly.com/question/29628193
#SPJ4
product remaining after the animal carcass has been processed
In actuality, carcass animal products can serve as the foundation for a wide range of other items, including soaps, paints, candles, plastics, and rubber goods.
There is zero chance that any bacteria or viruses will remain in the processed carcasses because all animal by-products are sterilized at extremely high temperatures.
To ensure thorough bleeding and ease of evisceration, animals should be kept off food for 12 to 24 hours before to slaughter while still having access to water (the removal of internal organs). Livestock are held in a chute that restricts their ability to move as the killing process gets underway.
Pre-slaughter handling, stunning, and slaughtering are the three separate steps involved in killing animals. The Humane Slaughter Act mandates that animals in the United States be treated humanely at each of these steps. meat processing; the fundamental slaughtering process.
To know more about carcass animal
https://brainly.com/question/9071405
#SPJ4
How does human life depend on mitosis?.
Answer:
Role of mitosis in Humans:
1. They aid in high cell number, often known as growth.
2. They aid in healing damaged cells or regeneration of cells in cuts or wounds.
3. Mitosis ensures genetic stability in freshly created cells.
Explanation:
Mitosis is the mechanism by which the daughter cells that are genetically identical to the parent cells are produced. The cell clones - or replicates - its chromosomes, then evenly divides the replicated chromosomes to ensure that each daughter cell has a complete set.
Your body has trillions of cells (thousands of millions). However, you began life as a single cell - a fertilized egg cell. This cell is then divided and divided again to produce other cells in a process known as mitosis.
Mitosis is a process that produces additional cells that are genetically identical to the original cell. It is essential for the development of embryos, as well as for the growth and development of human bodies. Mitosis is the process through which new cells are formed and old, destroyed, or damaged cells are replaced.
A cell splits into two identical daughter cells during mitosis. Because the daughter cells must have a copy of every chromosome, the process commences by duplicating the chromosomes and then meticulously segregating the copies to provide each new cell with a complete set.
Learn more:
https://brainly.com/question/1186551
In animal cells, a pair of small cylindrical structures composed of microutubules that duplicate during interphase and move to opposite ends of the cell during prophase.
Answer: Those would be the centrioles, where spindle fibers are released during metaphase.
Hope this helps :)
Explanation:
Can you make RNA in a lab?.
The capacity to reproduce itself is a basic characteristic of life. Now, scientists have developed the first ribonucleic acid molecules, a single-stranded relative of deoxyribose nucleic acid, that can replicate practically any other RNA.
A ribozyme called RNAP, also known as an all-RNA variant of RNAP, was developed in 1993 by researchers. It linked two short strands of RNA on a different template strand. The issue with all of these RNAP ribozymes is that they can only duplicate particular sequences of nucleotide bases, the components of RNA and DNA, and those sequences serve no significant functions in living cells. In order to encode the initial RNAP ribozyme, Joyce along with his assistant began by synthesizing a sizable library of DNA strands. To ensure that each of the final RNAPs was unique, they altered the DNA sequence at random. These RNAPs were included in a vial of short segments of RNA that the researchers wished to connect together on another template strand. The new strand would indicate RNAP ribozyme success by attaching to a particular molecular target in its vial if the new RNA was effectively produced. The team was able to identify any successes since each RNAP ribozyme was designed to stay attached to its unique, produced RNA strand. Then, a new round of evolution was initiated using each captured RNAP ribozyme as the starting point. The result of this test tube evolution, which took 24 rounds, was an RNAP ribozyme known as 24-3 polymerase. During this process, the scientists gradually raised the standards for what an effective RNAP ribozyme had to perform. The presence of specific RNAs could be amplified 10,000-fold by the 24-3 polymerase thanks to its capacity to duplicate previously duplicated RNAs. The polymerase chain reaction, a method extensively employed to replicate DNA, was given the first RNA version as a result.
To know more about the polymerase chain reaction click here,
https://brainly.com/question/28502368
#SPJ4
The human body contains as many as 1 ______ neurons.
The human body contains as many as 1 trillion neurons. A neuron, also known as a nerve cell, is the fundamental unit of the nervous system.
How many neurons are in the human body?Azevedo and others found that the average adult male brain weighs 1.5 kg and has 86 billion neurons and 85 billion semi cells, which are only 7 and 24% less than expected.
Is there more than one cell body in a neuron?Parts that make up a neuron. Like other cells, each has a soma, or cell body, that contains the nucleus, smooth and rough reticulum, Golgi, mitochondria, and other cellular components.
How many neurons are produced each day?During adulthood, your hippocampus actually produces approximately 1400 neurons per day of new brain cells. This was first noticed by scientists in the 1960s, but the idea that the adult brain could make new neurons (called neurogenesis) wasn't widely accepted until the 1990s and remained contentious for decades.
Incomplete question :
The human body contains as many as 1 ___ neurons.
a) million
b) billion
c) hundred thousand
d) trillion
Learn more about Neurons :
brainly.com/question/13061744
#SPJ4
What is the major concept of the biological theory of evolution?.
All species are connected and change gradually through time, according to the theory of evolution. The genetic diversity supports evolution in a population that has an impact on an organism's phenotypic features.
It is a shift in a set of organisms' characteristics across several generations. It includes everything from minute variations in the ratios of various gene types within a population to the modifications that resulted in the evolution of the earliest organism into dinosaurs, bees, oak trees, and humans. The earth's current species evolved from earlier, distinctly different species. In the natural world, individuals with specific mutations may have a higher chance of surviving the struggle for survival and procreating. If so, they would pass down any advantageous modifications to their progeny.
To know more about evolution please visit
https://brainly.com/question/29351017
#SPJ4
HELPPP PLEASE!!
Research methods of psychology and write a paragraph
One of the most prevalent approaches to learn what people believe and one of the most used research techniques in psychology are surveys.
How do you write a psychology paragraph?You must state your case succinctly and with clarity. There should be no superfluous words in a sentence and no superfluous phrases in a paragraph. Each paragraph should have a purpose or subject and make several points, each of which should be backed up by solid data.
Psychology is the name given to the scientific study of the mind and behavior. Psychologists are actively interested in researching and comprehending how the mind, the brain, and behavior work. The instruments and procedures used in research are what psychologists use to actually answer research questions.
To know more about psychology, visit:
https://brainly.com/question/12011520
#SPJ1
How does the atomic number affect the elements properties?.
Chemical properties of an element are determined by its atomic number. Bonding and other chemical properties are determined by the number of electrons in an atom. The number of electrons in a neutral atom is equal to the atomic number Z.
A nucleus and electrons that orbit the latter make up an atom. The number of protons (atomic number) in the nucleus, which consists of protons with a positive charge and neutrons without a charge, defines the chemical composition of the atom (element type). Each element has special qualities all its own. Each has a unique atomic number and mass number due to the varied amounts of protons and neutrons it contains.
Learn more about Atomic Number
brainly.com/question/13464692
#SPJ4
what part of the nervous system contains the brain and spinal cord; processes, stores and responds to information from the peripheral nervous system?
Central nervous system contains the brain and spinal cord processes, stores and responds to information from the peripheral nervous system.
In general, the central nervous system's is responsible for receiving, processing, and responding to all sensory information. They take help of peripheral nervous that is composed of nerves that branch off from the spinal cord and extend to all parts of the body.
Hence, brain and the spinal cord are enclosed and protected by bone brain is covered by bones of the skull, and the spinal cord inside a set of ring-shaped bones called vertebrae. They both are having cushioned layers that is also called meninges and a special fluid called cerebrospinal fluid.
To learn more about Central nervous system , here
brainly.com/question/29974261
#SPJ4
Sunlight is reflected, absorbed, and transmitted by earth's atmosphere. Which are the chief constituents of the electromagnetic energy that reaches earth's surface? select the two correct answers.
The atmosphere of Earth reflects, absorbs, and transmits solar radiation. Ultraviolet light and visible light are the main components of the electromagnetic energy that reaches the surface of the Earth.
The three main atmospheric components that absorb radiation are ozone, carbon dioxide, and water vapor. Most ultraviolet, X-, and gamma rays, which have shorter wavelengths than visible light, are absorbed by the earth's atmosphere. If high energy X- and gamma rays were to strike the earth's surface directly, the organisms and cells of beings would be harmed. The ozone layer, which is higher up in the stratosphere, absorbs solar ultraviolet radiation and influences how much heat from the sunlight is reflected back into space. We are protected by the ozone layer from the damaging effects of too much UV radiation, which can cause sunburn, skin cancer, and eye damage.
To learn more about sun light click here https://brainly.com/question/28613538
#SPJ4
Where are ADA enzymes?.
Adenosine deaminase is produced using instructions from the ADA gene.
All cells produce this enzyme, but the immune system's lymphocytes—which form in lymphoid tissues—create the most adenosine deaminase. The thymus, a gland found behind the breastbone, and lymph nodes, which are present all over the body, are examples of these lymphoid structures. The immune system, which protects the body from potentially hazardous intruders like viruses and bacteria, is made up of lymphocytes.
The adenosine deaminase enzyme's job is to get rid of the deoxyadenosine molecule that is produced when DNA is broken down. Deoxyadenosine, which is hazardous to lymphocytes, is changed into the harmless deoxyinosine by the enzyme adenosine deaminase.
To learn more about ADA enzymes click here:
https://brainly.com/question/30277919
#SPJ4
B lymphocytes produce antibodies when they are activated by :
Answer:
Bacterium.
Explanation:
Lymphocytes produce antibodies that fight and kill bacteria.
Which element is responsible for bone growth?
Answer: Calcium
Explanation:
Why did Darwin use the Galapagos Islands as the main source of his research?.
The islands are noted for having an enormous range of rare species. On these islands, Darwin began formulating his evolutionary theory. The same kind of animal varied from one island to the next, according to Darwin, who observed this in the Galápagos.
The ship made a halt at the Galapagos Islands after examining South America's coastlines. When Darwin visited the islands, he saw that the rare species were similar from island to island but perfectly adapted to their environs, which made him wonder where the occupants of the islands had come from.
The finches that bear his name today are among those that moved Darwin so deeply. Darwin later used the supposition that these finches were all descended from the same ancestry to inform some of his theories.
To know more about evolutionary theory
brainly.com/question/6111443
#SPJ4
A colostomy is the surgical creation of an artificial opening between the colon and the body surface
True, a colostomy is the surgical creation of an artificial opening between the colon & the body surface.
What exactly is a colostomy?A colostomy is surgery that involves bringing a portion of the large intestine (the colon) to the surface of the body to produce a stoma, which is an artificial opening on the exterior of the abdomen (tummy). The waste from the colon is subsequently collected with the use of a tiny bag known as a stoma pouch.
The colon is the first one to one and a half metres of your big intestine. It collects water and nutrients from your faeces and excretes the remainder to the rectum.
If your colon, rectum, or anus do not function correctly, surgery can establish a new mechanism for your body to eliminate waste. The stoma of a colostomy allows faeces and gas to exit your body.
To learn more about colostomy follow the given link: https://brainly.com/question/28084644
#SPJ4
Complete question:
True or False.
A colostomy is the surgical creation of an artificial opening between the colon & the body surface.
True, a colostomy is the surgical creation of an artificial opening between the colon & the body surface.
What exactly is a colostomy?A colostomy is surgery that involves bringing a portion of the large intestine (the colon) to the surface of the body to produce a stoma, which is an artificial opening on the exterior of the abdomen (tummy). The waste from the colon is subsequently collected with the use of a tiny bag known as a stoma pouch.
The colon is the first one to one and a half metres of your big intestine. It collects water and nutrients from your faeces and excretes the remainder to the rectum.
If your colon, rectum, or anus do not function correctly, surgery can establish a new mechanism for your body to eliminate waste. The stoma of a colostomy allows faeces and gas to exit your body.
To learn more about colostomy follow the given link: brainly.com/question/28084644
#SPJ4
Complete question:
State whether the given statement is True or False.
A colostomy is the surgical creation of an artificial opening between the colon & the body surface.
What is the main aim of the scientific method in the research field Mcq?.
The goal of scientific research is often to come up with testable explanations that may be used to forecast the outcomes of upcoming trials. All scientific approaches have the same objective, which is to analyze the initial observation.
The reproducibility of the scientific method is one of its key characteristics. A functioning hypothesis' experiments must be meticulously documented in order for others to duplicate them and eventually lead to the hypothesis' acceptance. The scientific method is intended to offer clear processes for analytically responding to a research question. The first step in the scientific process is for scientists to make observations regarding the problem at hand. Following that, they investigate what is already known about the subject and develop a hypothesis to address their query.
To know more about the research please visit
https://brainly.com/question/24174276
#SPJ4
The use of empirical evidence, or proof through observation or experiment, to confirm or disprove theories and hypotheses.
Individual viewpoints and beliefs on the final result. Replicability: The capacity of other researchers to reproduce the investigation and produce comparable outcomes, so confirming the veracity of the conclusions. Parsimony is the practice of relying on the most straightforward explanation that makes sense of the data rather than more complicated or improbable ones. Through peer review and replication, the scientific community has the capacity to recognize and address mistakes or inconsistencies in the research. In conclusion, scientific research is distinguished by its reliance on empirical data, objectivity in methodology, replication, parsimony, and self-correction, all of which contribute to the validity and reliability of the results.
Learn more about Parsimony here:
https://brainly.com/question/30336884
#SPJ4
What factors cause leaves to change color?.
Autumn leaf color is influenced by three factors:
Pigments found in leavesDuration of the nightThe weatherThe calendar controls the timing of color changes and the onset of falling leaves as the nights grow longer. None of the other environmental influences, such as temperature, rainfall, and food supply, are as consistent as the increasing length of night during autumn. As the days shorten and the nights lengthen and cool, biochemical processes in the leaf begin to paint the landscape with Nature's autumn palette.
A color palette requires pigments, and three types are present in autumn color: carotenoids, anthocyanin, and chlorophyll.
Throughout the growing season, chlorophyll and carotenoids are found in the chloroplasts of leaf cells.
To know more about leaves click here,
https://brainly.com/question/14949275
#SPJ4
yeasts can perform both aerobic respiration and fermentation. in fact, the homebrewer must be careful that oxygen is not introduced into the carboy once the yeast begin fermentation. what would be the products if o2 is allowed to enter the carboy?
Beer would be the product if oxygen is allowed to enter the carboy.
Brewing beer at home requires careful control of oxygen levels in the carboy.
If oxygen is allowed to enter the carboy after the yeast have begun fermentation, it can have a major impact on the final product.
Yeast can perform both aerobic respiration and fermentation, and the introduction of oxygen during fermentation can result in a beer that is less flavorful, cloudy, and has a shorter shelf life.
To ensure a great tasting and long-lasting beer, it is important to be mindful of oxygen levels and avoid introducing oxygen after fermentation has begun.
To learn more about fermentation, click here:
https://brainly.com/question/13050729
#SPJ4
In three to five sentences, describe how the diagram of Earth's carbon cycle demonstrates the interactions among the biosphere (plants), the lithosphere (ground), the atmosphere (air), and the hydrosphere (water). CARBON CYCLE photosynthesis animal organic respiration carbon decaying organisms CO₂ ocean uptake dead organisms and waste products plant respiration root respiration fossils and fossil fuels factory and vehicle emissions mineral carbon
Did Jamie cheat on Claire with Malva?.
Claire and Jamie stop having children after Brianna. By the end of the second season/book, Claire is walking across the stones while carrying Brianna.
Faith Fraser, Claire and Jamie's firstborn, passed away while still in the womb. She gave birth in Paris, France, following a precarious pregnancy. She was laid to rest in the Hospital des Agnes cemetery by Mother Hildegarde. Faith was the stillborn child in France. Jamie was never allowed to meet Mother Hildegarde, who baptized the child despite it being against the law. While he was in the Bastille, Claire was on the verge of passing away from childbed fever. Master Raymond rescued her from that. Brianna was born in 1948, despite being conceived in 1746. Brianna didn't discover the truth until after Frank had passed away, but she was the child Frank would raise for the length of her youth as his own.
Learn more about Jamie here:
https://brainly.com/question/30099448
#SPJ4
Which i an abiotic factor?
O A) fungi and mo on a rotting log
O B) a foret of deciduou tree
O C) a polar bear on an ice floe
O D) an ocean current of cold water
An ocean current of cold water is the abiotic factor. Abiotic factor is define as the non-living components.
Abiotic factors are non-living components of an ecosystem that influence their surroundings. Examples could be light, water, and temperature in a terrestrial habitat. Abiotic elements in a marine ecosystem include salinity and ocean current.
The living species that directly or indirectly affect other organisms in an environment are referred to as biotic components. For instance, consider plants, animals, bacteria, and the waste products they produce. The non-living, or abiotic, aspects of an ecosystem include all chemical and physical substances.
So, the fungi mould on the rotting log, a forest of deciduous tree, a polar bear on an ice floe are biotic factors. and An ocean current of cold water is abiotic factor.
For more such questions on Abiotic components, Visit: brainly.com/question/12689972
#SPJ4
genes that are likely inherited together due to their physical proximity is called ?
Genetic linkage describes a group of genes that are likely to inherit together because they are close together.
The alleles of genes that are together on a chromosome are more likely to be handed down as a pair. Genes that are sufficiently close to one another on a chromosome have a propensity to "remain together." The phrase for this phenomenon is genetic linkage.
Physical proximity between two genetic markers makes it less difficult for them to be split off onto distinct chromatids during chromosomal crossover, and as a result, they are considered to be more connected than markers that are physically far apart.
In other words, the lower the likelihood of recombination between two genes, and the higher the likelihood that they will be inherited together, the closer they are to one another on a chromosome.
To learn more about Genetic linkage, refer
https://brainly.com/question/22173626
#SPJ4
The leaves of a plant appear green because chlorophyll a. reflects blue light b. absorbs blue light c. reflects green light d. absorbs green light
Chlorophyll can absorb blue-violet and red regions of the visible spectrum when they photosynthesize using light. Since green is the color in which chlorophyll could not absorb, green light is reflected. As a result, the leaves of plant appear green.
what is chlorophyll?
Chlorophyll is pigment that gives plants their green color, and it helps plants create their own food through photosynthesis
It allow plants to absorb energy from light. Chlorophyll is responsible for green color of many plants and algae
In plants, chlorophyll is major photosynthetic pigment. The chloroplast contains great number of the chlorophyll pigments to absorb light energy. Some plants grow shoot that is green throughout. Examples are herbs that have abundant chlorophyll pigments not just in leaves but also on stems.
The green pigment chlorophyll is located within the thylakoid membrane, and space between the thylakoid and the chloroplast membranes is called stroma
learn more about chlorophyll at
https://brainly.com/question/18606966
#SPJ4
5. Describe how a warming climate could affect baby Ringed Seals.
what would be the dependent and independant variable
Both dependent and independent variable are found in an experiment.
What is dependent and independent variable?An independent variable is a variable that is being manipulated in an experiment or study to observe its effects on another variable. The independent variable is changed by the researcher to determine its impact on the dependent variable.
A dependent variable is a variable that is being measured or observed in an experiment or study in response to changes in the independent variable. The value of the dependent variable depends on the value of the independent variable. It is the variable being affected by the changes made to the independent variable.
Learn more about independent variable:https://brainly.com/question/29430246
#SPJ1
